Skip to content
K Knidox Search…
Biology · Sequence tools

Primer Melting Temperature

Melting temperature by nearest-neighbour thermodynamics, with the two rough estimates alongside.

5′ → 3′. Whitespace and FASTA headers are ignored. Ambiguity codes have no nearest-neighbour value, so only the rough estimates appear for them.
nM
Total strand concentration. 250 nM is a common PCR default.
mM
50 mM matches most standard PCR buffers.
Melting temperature — nearest neighbour
56.8°CIn the usual 50–65 °C working range

20 nt · 60.0% GC · 250 nM primer, 50 mM Na⁺

Nearest neighbour
56.8 °C
Most accurate; accounts for sequence and conditions
Salt-adjusted GC
50.8 °C
Reasonable for roughly 14–70 bases
Wallace rule
64 °C
Only for oligos under about 14 bases
Reverse complement — the other primer of the pair

CAATGCCTCCAGGTCCAGAC

A primer’s melting temperature is where half of it is bound to its template. It depends on sequence, salt and concentration — not just length. A 20-base primer at 60% GC in standard PCR buffer melts near 57 °C, and the annealing step is usually set a few degrees below that.

Three ways to estimate it, and why they disagree

The Wallace rule, 2(A+T) + 4(G+C), is arithmetic you can do in your head. It ignores salt, concentration and the order of the bases entirely, and it was only ever intended for oligos shorter than about fourteen bases. Above that it runs several degrees high.

The salt-adjusted GC formula does better over the 14–70 base range because it accounts for length and ionic strength. But it still treats the sequence as a bag of bases, so it cannot tell GCGCGC from GGGCCC even though those two stack very differently.

Nearest-neighbour thermodynamics is what modern primer design uses. It assigns an enthalpy and entropy to each adjacent base pair step — there are only ten distinct ones — sums them along the sequence, adds an initiation term for each end, then corrects for salt and strand concentration. The tool reports all three so the gap between them is visible; where they disagree, the nearest-neighbour value is the one to trust.

Tm is not the annealing temperature

Tm describes the primer-template duplex; the annealing temperature is a setting on a thermocycler. Convention is to anneal a few degrees below the lower of the two primer Tm values, and many protocols use Ta = Tm − 5 °C as a starting point before optimising. What matters more than the absolute number is that the two primers of a pair are matched — a difference of more than about 5 °C means one anneals well while the other does not.

Tm = ΔH° ÷ (ΔS° + R · ln(CT/4)) − 273.15

ΔH° and ΔS° summed over the nearest-neighbour steps; R = 1.987 cal/(mol·K); C_T the total strand concentration

  1. 1
    Break the sequence into overlapping pairs. GTCTGG gives GT, TC, CT, TG, GG — a 20-base primer has 19 such steps.
  2. 2
    Look up ΔH and ΔS for each step. There are only ten distinct values, because a step and its reverse complement are the same stack seen from the other strand.
  3. 3
    Add an initiation term for each end. A terminal G or C contributes differently from a terminal A or T, since an A·T end frays more easily.
  4. 4
    Correct the entropy for salt. Cations shield the backbone charges, so more salt stabilises the duplex and raises Tm.
  5. 5
    Solve for the temperature. Substituting into the equation gives 56.8 °C for a 20-base, 60% GC primer at 250 nM and 50 mM Na⁺.

What each estimate is for

All three appear in the tool; they diverge most for long or unusually composed primers.

MethodUseful rangeAccounts for
Wallace ruleUnder ~14 basesBase counts only
Salt-adjusted GC~14–70 basesLength, GC%, salt
Nearest neighbourAny length above ~8 basesSequence order, salt, concentration

What a usable PCR primer normally looks like

Guidelines rather than rules — a primer outside them can still work, and one inside them can still fail.

PropertyTypical target
Length18–24 bases
Tm55–65 °C
GC content40–60%
Tm difference within a pairUnder 5 °C
3′ endG or C helps anchor the extension
AvoidRuns of four or more identical bases, and self-complementarity

The conditions change the answer

Tm is not a property of the sequence alone, which is why a value quoted without conditions is incomplete. Raising monovalent salt from 50 mM to 1 M lifts the example primer from about 57 °C to 72 °C, because the cations screen the repulsion between the two negatively charged backbones. Dropping the primer concentration lowers Tm, since a duplex is less likely to find its partner when there is less of it about.

Two limits are worth stating. The model assumes a perfectly matched duplex, so a primer with a deliberate mismatch — adding a restriction site, say — melts lower than the calculation suggests, and the usual approach is to compute Tm for the annealing portion only. And magnesium, which PCR buffers contain and which stabilises duplexes strongly, is not included in a simple monovalent correction; tools that model it apply a separate divalent term.

What does melting temperature mean for a primer?
The temperature at which half the primer molecules are bound to their complementary template and half are free. It describes the stability of that duplex under the stated salt and concentration conditions.
Which Tm formula should I use?
Nearest neighbour, for anything longer than about eight bases. The Wallace rule is a mental shortcut for short oligos and the GC formula a reasonable middle ground, but only nearest neighbour accounts for the order of the bases.
What annealing temperature should I set?
Conventionally a few degrees below the lower primer Tm — many protocols start at Tm − 5 °C and optimise from there. A gradient across several temperatures is the reliable way to find the best one for a new pair.
Why does salt concentration change the Tm?
Because the DNA backbone is negatively charged and the two strands repel each other. Cations screen that repulsion, so more salt stabilises the duplex and raises the melting temperature.
Does primer concentration matter?
Yes. A higher concentration makes it more likely that a primer finds its partner, so the duplex survives to a higher temperature. The effect is logarithmic, so a fivefold change moves Tm by only a couple of degrees.
Why do my two primers need similar Tm values?
Because they share one annealing temperature. If they differ by more than about 5 °C, a temperature that suits one will be too high or too low for the other, giving poor yield or non-specific product.
What about a primer with a mismatched tail?
Calculate the Tm of the annealing portion only. A 5′ tail carrying a restriction site or an overhang does not pair with the template in the first cycles, so including it overstates the stability.